10  searching for a large number of objects

Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx

Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx

Ngày tải lên : 23/06/2014, 00:20
... Complex and Adaptive Laboratory, involved in artificial intelligence applications His main interests are radar data processing, navigation, and air traffic management, with special stress on data fusion ... conditions are classified with respect to radar and aircraft characteristics because of the very different behavior of any tracker for varying input conditions Radar parameters represent the accuracy and ... respect to the radar (radial and tangential projection of velocity heading), magnitude of the transversal acceleration, and magnitude of the groundspeed change There are four quality parameters in...
  • 14
  • 342
  • 0
Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

Ngày tải lên : 14/08/2014, 17:22
... Biosystems) Data Our data are freely available at the proteome database of the department of proteomics and signal transduction of the Max-Planck-Institut for Biochemistry [45] Additional data files ... following additional data are available with the online version of this paper Additional data file lists all peptides and protein hits obtained in both LTQ-FT and LTQ-Orbitrap data Click here data Orbitrap ... they had at least two peptides with score higher than 35 For Orbitrap data, the criteria were a mass accuracy within ppm (average absolute peptide mass accuracy was 1.22 ppm) and at least fully...
  • 11
  • 289
  • 0
Báo cáo khoa học: "Searching for Topics in a Large Collection of Texts" doc

Báo cáo khoa học: "Searching for Topics in a Large Collection of Texts" doc

Ngày tải lên : 08/03/2014, 04:22
... sort of machine learning, using a small manually annotated collection of texts When optimized -parameters are used, the Local Search procedure tries to simulate the behavior of human annotator ... Proceedings of the International Symposium on Information and Communication Technologies, pages 311–316 Trinity College Dublin, Ireland JAMA 2004 JAMA: A Java Matrix Package Publicdomain, http://math.nist.gov/javanumerics/jama/ ... that a positive value will significantly accelerate the computation of without loss of quality, but finding the right value must be based on the evaluation As for the most important parameters of...
  • 6
  • 447
  • 0
Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx

Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx

Ngày tải lên : 08/03/2014, 19:20
... funding currently available for wind engineering research, advances are being made in a number of areas, such as the characterization of wind fields and the evaluation of the performance of the building ... Engineering Institute of Canada; Golden Plate Award, American Academy of Achievement; International Award of Merit in Structural Engineering, International Association of Bridge and Structural Engineering; ... to an LSWTF are available that could potentially provide much of the same data A variety of tools for research on wind-resistant structures are available, including analysis, numerical computation,...
  • 49
  • 588
  • 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Ngày tải lên : 15/03/2014, 21:20
... find partners To what extent is the partnership rate of heterosexual women of a certain age a reasonable measure of the lack of availability of partners for single men of the same age group (and ... the great majority of potential mates cannot easily be gathered Rosenfeld and Thomas, Searching for a Mate P.1 In this paper we exploit unique features of a new nationally representative dataset ... Rosenfeld and Thomas, Searching for a Mate P.13 early 1940s family had already been overtaken by friends as the primary way male-female couples met The steady decline of family as a broker in relationship...
  • 50
  • 470
  • 0
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf

Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf

Ngày tải lên : 23/06/2014, 01:20
... classes An analytical demonstration is provided for a special case of a piecewise linear variation of the autocorrelation matrix eigenvalues Although this model is very simple, it contains all ... to a high-resolution radar application The goal is to find the most accurate estimate of the range profile of a radar target using its complex signature in the frequency domain An Estimation of Number ... the larger is the dynamic range ∆λ1 The eigenvalue variation is not necessarily linear, but the results obtained in this case can be generalized This type of variation has also the advantage of...
  • 12
  • 409
  • 0
Báo cáo hóa học: " Evolutionary Techniques for Image Processing a Large Dataset of Early Drosophila Gene Expression" pptx

Báo cáo hóa học: " Evolutionary Techniques for Image Processing a Large Dataset of Early Drosophila Gene Expression" pptx

Ngày tải lên : 23/06/2014, 01:20
... , w and h are initial spatial coordinates, and w0 , h0 , A, B, C, and D are parameters The y-coordinate remains the same while the x-coordinate is transformed as a function of both coordinates ... individual as the object to be optimized The character data of the individual is the parameters to be optimized in an evolutionary-based process These parameters are arranged as vectors of real numbers ... research interests are in computational biology and bioinformatics, web databases, data mining, artificial intelligence, evolutionary computations, animates, artificial life, and evolutionary biology...
  • 10
  • 255
  • 0
Báo cáo toán học: "An Asymptotic Expansion for the Number of Permutations with a Certain Number of Inversions" docx

Báo cáo toán học: "An Asymptotic Expansion for the Number of Permutations with a Certain Number of Inversions" docx

Ngày tải lên : 07/08/2014, 06:20
... a substantially improved paper the electronic journal of combinatorics (2000), #R50 11 References [1] M Abramowitz and I .A Stegun, Eds., Handbook of Mathematical Functions with Formulas, Graphs ... uniformly for all real numbers x Our result follows since, apart from the error term, the smallest term in (29) has order of magnitude at least n−m−1 for x2 = x2 (n) ≤ ln n As a consequence of ... ln n and m is a fixed integer at least 2 Here, H2q are the Hermite polynomials defined before Theorem and the S2q are defined in Theorem In particular, we have a complete asymptotic expansion for...
  • 11
  • 348
  • 0
Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx

Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx

Ngày tải lên : 13/08/2014, 09:20
... β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, LOX1(reverse): CCTAGAGTCGCAGCAGCCAG, ... responsible for the pattern observed in the dendrogram, a two-way ANOVA was fit to each probeset using activation and knockdown state as explanatory variables A linear contrast analysis was then performed ... oligonucleotide array data via quantitative real-time PCR BMC Bioinformatics 2006, 7:23 Wettenhall JM, Smyth GK: limmaGUI: a graphical user interface for linear modeling of microarray data Bioinformatics...
  • 16
  • 178
  • 0
Life and Physical Sciences Research for a New Era of Space Exploration docx

Life and Physical Sciences Research for a New Era of Space Exploration docx

Ngày tải lên : 05/03/2014, 11:21
... Administrative Coordinator TANJA PILZAK, Manager, Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant ... Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant viii AERONAUTICS AND SPACE ENGINEERING BOARD RAYMOND ... there are substantial problems with translational research efforts in space exploration A critical advantage of the ISS is that it provides a platform for research programs that can, in fact,...
  • 47
  • 606
  • 0
Research Program of the Partnership for a New Generation of Vehicles doc

Research Program of the Partnership for a New Generation of Vehicles doc

Ngày tải lên : 06/03/2014, 15:20
... Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National Laboratory, and the Department of ... Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering viii Acknowledgments The committee wishes to thank all of the members of the Partnership ... Jersey Staff JAMES ZUCCHETTO, Director RICHARD CAMPBELL, Program Officer ALAN CRANE, Program Officer MARTIN OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant...
  • 134
  • 466
  • 0
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Ngày tải lên : 07/03/2014, 21:20
... BMP/activin pathway in Crassostrea gigas A Herpin et al A Crassostrea gigas C2 domain ALK-6 E fluviatilis C2 domain 77 Crassostrea gigas C1 domain 76 88 Wit D melanogaster ActR-2b H sapiens 92 Activin ... (blastula, gastrula, trochophore larvae, D larvae, and 14 days post fertilization larvae, pediveliger larvae and metamorphosing larvae) were used as samples Although Cg-BMPR1 and Cg-TGFbsfR2 transcripts ... method of the PAUP package The percentage recovery of the branch in 1000 bootstrap replications is indicated ActR2b Carassius auratus (ABB58749)Daf-1 Caenohabditis elegans (P20792), Daf-4 Caenohabditis...
  • 17
  • 508
  • 0
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

Ngày tải lên : 15/03/2014, 07:20
... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data forecasts ... obtain parameter estimates From the parameter estimates we use the Kalman filter to obtain estimates of the latent factors 3.3 Calculation of Model Estimates For a given set of model parameters and ... inflation expectations and inflation risk premia Due to a lack of data, we cannot this, and instead we estimate inflation forward rates as part of our model Vol No Estimating Inflation Expectations...
  • 32
  • 347
  • 0
Bacteria constitute a large domain of prokaryotic microorganisms.

Bacteria constitute a large domain of prokaryotic microorganisms.

Ngày tải lên : 15/03/2014, 13:09
... between bacterial and viral DNA RNA polymerase causes mRNA to be made from cell for virus Viral DNA takes over and produces more DNA and viral proteins Replication – Virus uses bacterial material to ... example PROKARYOTIC CELLS • Prokaryote – what does that mean? Classification of Prokaryotes • All prokaryotes were in kingdom Monera • Now – kingdoms – Eubacteria and archaebacteria Archaebacteria ... things They are dependent on living things to survive EUBACTERIA AND ARCHAEBACTERIA: The two bacterial kingdoms Bacteria on a pin head Eubacteria • “True” bacteria • largest Kindgom of prokaryotes...
  • 40
  • 267
  • 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Ngày tải lên : 16/03/2014, 00:20
... design of potential coadjuvants of those antimicrobial agents that are already available after incubation for 18–20 h at 37 °C Antibacterial activity was expressed as MIC, the concentration of peptide ... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... to allow one missed cleavage per peptide, a mass tolerance of 0.5 Da, and for carbamido-methylation of cysteines to be considered as a fixed modification and oxidation of methionines as a variable...
  • 18
  • 494
  • 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Ngày tải lên : 16/03/2014, 04:20
... Merilainen et al ¨ Table Calorimetric analysis of CoA binding to the Z ramigera biosynthetic thiolase at 25 °C The values and error estimates are calculated from separate measurements (three for ... referred to as Wat82, and Ne2(His348) This oxyanion hole binds the Ac-CoA thioester oxygen atom, facilitating the nucleophilic attack of the C2 atom of Ac-CoA to the carbonyl carbon atom of the acetyl ... reaction uses two molecules of Ac-CoA to generate AcAc-CoA and CoA Cys89 is activated for nucleophilic attack by His348 (B) Comparison of the covalent structures of CoA (top), SPP (middle) and...
  • 13
  • 472
  • 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

Ngày tải lên : 22/03/2014, 20:20
... of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data forecasts are then used to update the estimates of the state and its variance The algorithm ... this paper are those of the authors and are not necessarily those of the Reserve Bank of Australia Author: finlayr at domain rba.gov.au Media Of ce: rbainfo@rba.gov.au Abstract We estimate inflation ... inflation expectations and inflation risk premia Due to a lack of data we cannot this and instead estimate inflation forward rates as part of our model 18 inflation, a low 2-year break-even inflation...
  • 39
  • 395
  • 0
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx

Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx

Ngày tải lên : 02/04/2014, 13:20
... trọng Sau A large amount of a great deal of danh từ không đếm Ví dụ: * She has spent a great deal of time in Europe Sau A large number of trước danh từ số nhiều, động từ theo sau chia theo chủ ... danh từ số nhiều Ví dụ: * There is plenty of time * Plenty of shops accept credit cards A large amount of, a great deal of , a large number of Cách diễn đạt mang tính tương đối trang trọng Sau ... động từ chia tương ứng với dạng số nhiều Ví dụ: * A lot of my friends live abroad * Lots of time is needed to learn a language Plenty of Plenty of mang ngh a : “đủ nhiều n a , theo sau danh từ không...
  • 6
  • 1.7K
  • 11
context-aware pervasive systems architectures for a new breed of applications

context-aware pervasive systems architectures for a new breed of applications

Ngày tải lên : 01/06/2014, 00:18
... systems (a combination of hardware and software)13 that are aware of context and can automatically adapt and respond to such context Context awareness enables the system to take action automatically, ... RFID readers and tags) An interesting application of RFID tags is to construct a model of the configuration of a number of physical parts; for example, given a collection of tagged parts such as those ... location of an individual within a suburb or town (around 150 to 300-m accuracy) in the case of an emergency call On a smaller scale, such as within an area of a radius of the several hundreds of kilometers,...
  • 240
  • 244
  • 0